Service Overview

Amplicon sequencing is frequently used to identify and differentiate microbial species. Short (<500 bp) hypervariable regions of conserved genes or intergenic regions are amplified by PCR and analyzed using NGS technology, and the resulting sequences are compared against microbial databases.

For bacteria and archaea, the 16S rRNA gene is the most common target for amplicon sequencing. For fungi, three targets are generally used: the 18S rRNA gene and two internal transcribed spacers (ITS) located between rRNA genes. These regions are usually sufficiently divergent to separate even highly related species, and can sometimes differentiate subspecies.

Service Information

Sequencing Strategy

  • 130-470 bp insert DNA library
  • HiSeq platform, paired-end 250 bp
TARGETREGIONFRAGMENT LENGTHPRIMERPRIMER SEQUENCES (5’- 3’)
Bacterial
16S rDNA
V4292 bp515FGTGCCAGCMGCCGCGGTAA
806RGGACTACHVGGGTWTCTAAT
V3-V4466 bp341FCCTAYGGGRBGCASCAG
806RGGACTACNNGGGTATCTAAT
V4-V5393 bp515FGTGCCAGCMGCCGCGGTAA
907RCCGTCAATTCCTTTGAGTTT
Archaeal
16S rDNA
V4397 bp519FCAGCCGCCGCGGTAA
915RGTGCTCCCCCGCCAATTCCT
288 bpU519FCAGYMGCCRCGGKAAHACC
806RGGACTACNSGGGTMTCTAAT
Fungal
18S rDNA
V4179 bp528FGCGGTAATTCCAGCTCCAA
706RAATCCRAGAATTTCACCTCT
V9131 bp1380FCCCTGCCHTTTGTACACAC
1510RCCTTCYGCAGGTTCACCTAC
Fungal
ITS*
ITS1307 bpITS5-1737FGGAAGTAAAAGTCGTAACAAGG
ITS2-2043RGCTGCGTTCTTCATCGATGC
ITS2386 bpITS3GCATCGATGAAGAACGCAGC
ITS4TCCTCCGCTTATTGATATGC

* ITS1 is located between the 18S and 5.8S rRNA genes; ITS2 is located between the 5.8S and 28S rRNA genes.

Data Quality Guarantee

  • The amount of data for each sample is not less than 30,000 tags, 50,000 tags or 100,000 tags.